Review



mouse anti her2 mab  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    R&D Systems mouse anti her2 mab
    Mouse Anti Her2 Mab, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+mouse+erbb2+her2+mab/Human+ErbB2%2FHer2+Antibody/pm41872362-174-60-63
    Average 94 stars, based on 24 article reviews
    mouse anti her2 mab - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    FACS:

    Article Title: Development of Highly Sensitive Anti-Mouse HER2 Monoclonal Antibodies for Flow Cytometry
    Article Snippet: The mHER2 plasmid was transfected into CHO-K1 and LN229 cells, using a Neon transfection system (Thermo Fisher Scientific Inc., Waltham, MA, USA). .. Stable transfectants were established through cell sorting via a cell sorter, SH800 (Sony Corp., Tokyo, Japan) using an anti-mouse ErbB2/Her2 mAb (clone 666521, R&D systems, Minneapolis, MN, USA), after which cultivation in a medium containing 0.5 mg/mL of G418 (Nacalai Tesque, Inc., Kyoto, Japan) was conducted. .. The mHER2 knockout NMuMG (BINDS-51) was generated by transfecting 10 μg of CRISPR/Cas9 plasmids for mHER2 (Guide RNA: AGAGGTTGCGCATCGTGAGA, Thermo Fisher Scientific, Inc.) into NMuMG cells using the Neon transfection system and established through cell sorting as described above.



    Similar Products

    mouse monoclonal 10004 mm42  (Sino Biological)
    93
    Sino Biological mouse monoclonal 10004 mm42
    Mouse Monoclonal 10004 Mm42, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+mouse+erbb2+her2+mab/Her2%2FERBB2+Antibody%2C+Mouse+MAb/10__1016_slash_j__electacta__2025__148092-64-16-25
    Average 93 stars, based on 1 article reviews
    mouse monoclonal 10004 mm42 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    mouse anti her2 mab  (R&D Systems)
    94
    R&D Systems mouse anti her2 mab
    Mouse Anti Her2 Mab, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+mouse+erbb2+her2+mab/Human+ErbB2%2FHer2+Antibody/pm41872362-174-60-63
    Average 94 stars, based on 1 article reviews
    mouse anti her2 mab - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    mouse anti her2  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc mouse anti her2
    Mouse Anti Her2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+mouse+erbb2+her2+mab/HER2%2FErbB2+Mouse+mAb/pmc12979841-35-0-3
    Average 93 stars, based on 1 article reviews
    mouse anti her2 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    anti her2 erbb2 antibody fitc  (Sino Biological)
    94
    Sino Biological anti her2 erbb2 antibody fitc
    Anti Her2 Erbb2 Antibody Fitc, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+mouse+erbb2+her2+mab/Her2+%2F+ERBB2+Antibody%2C+Mouse+MAb/pmc12665891-148-0-8
    Average 94 stars, based on 1 article reviews
    anti her2 erbb2 antibody fitc - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    antibodies mab  (Sino Biological)
    93
    Sino Biological antibodies mab
    Antibodies Mab, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+mouse+erbb2+her2+mab/HER2+%2F+ErbB2+%2F+CD340+Antibody%2C+Mouse+MAb/pmc12654033-125-4-9
    Average 93 stars, based on 1 article reviews
    antibodies mab - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    anti phospho chk1 s345  (Cell Signaling Technology Inc)
    93
    Cell Signaling Technology Inc anti phospho chk1 s345
    Anti Phospho Chk1 S345, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+mouse+erbb2+her2+mab/HER2%2FErbB2+Mouse+mAb/pm40934081-419-71-74
    Average 93 stars, based on 1 article reviews
    anti phospho chk1 s345 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    antibodies mabs  (Sino Biological)
    93
    Sino Biological antibodies mabs
    ( A ) UV–Vis spectra showing the stepwise functionalization and bioconjugation of gold GNUs exhibiting an LSPR peak at 675 nm, PEG-functionalized GNUs, ADH-functionalized GNU-PEG with a peak at 220 nm, and <t>mAb-conjugated</t> GNU-PEG-ADH displaying a peak at 230 nm followed by a characteristic peak at 214 nm after the interaction. ( B ) Magnified view of ( A ) between 200 and 300 nm. ( C ) Magnification of ( B ) between 270 and 290 nm, where the mAb shows higher absorbance <t>than</t> <t>HER-II,</t> and the corresponding results for CA 15-3 from ( D – F ). Note the higher absorbance of CA 15-3 than the mAb.
    Antibodies Mabs, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+mouse+erbb2+her2+mab/HER2+%2F+ErbB2+%2F+CD340+Antibody%2C+Mouse+MAb/pmc12293741-199-4-9
    Average 93 stars, based on 1 article reviews
    antibodies mabs - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    cell signaling pcna mouse  (Cell Signaling Technology Inc)
    96
    Cell Signaling Technology Inc cell signaling pcna mouse
    ( A ) UV–Vis spectra showing the stepwise functionalization and bioconjugation of gold GNUs exhibiting an LSPR peak at 675 nm, PEG-functionalized GNUs, ADH-functionalized GNU-PEG with a peak at 220 nm, and <t>mAb-conjugated</t> GNU-PEG-ADH displaying a peak at 230 nm followed by a characteristic peak at 214 nm after the interaction. ( B ) Magnified view of ( A ) between 200 and 300 nm. ( C ) Magnification of ( B ) between 270 and 290 nm, where the mAb shows higher absorbance <t>than</t> <t>HER-II,</t> and the corresponding results for CA 15-3 from ( D – F ). Note the higher absorbance of CA 15-3 than the mAb.
    Cell Signaling Pcna Mouse, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+mouse+erbb2+her2+mab/HER2%2FErbB2+Rabbit+mAb/pmc11602300__Table2-1-35-35
    Average 96 stars, based on 1 article reviews
    cell signaling pcna mouse - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    recombinant anti her2 fitc conjugated antibody  (Sino Biological)
    93
    Sino Biological recombinant anti her2 fitc conjugated antibody
    ( A ) UV–Vis spectra showing the stepwise functionalization and bioconjugation of gold GNUs exhibiting an LSPR peak at 675 nm, PEG-functionalized GNUs, ADH-functionalized GNU-PEG with a peak at 220 nm, and <t>mAb-conjugated</t> GNU-PEG-ADH displaying a peak at 230 nm followed by a characteristic peak at 214 nm after the interaction. ( B ) Magnified view of ( A ) between 200 and 300 nm. ( C ) Magnification of ( B ) between 270 and 290 nm, where the mAb shows higher absorbance <t>than</t> <t>HER-II,</t> and the corresponding results for CA 15-3 from ( D – F ). Note the higher absorbance of CA 15-3 than the mAb.
    Recombinant Anti Her2 Fitc Conjugated Antibody, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/anti+mouse+erbb2+her2+mab/Her2+%2F+ERBB2+Antibody+(FITC)%2C+Mouse+MAb/pm38702509-95-0-9
    Average 93 stars, based on 1 article reviews
    recombinant anti her2 fitc conjugated antibody - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results


    ( A ) UV–Vis spectra showing the stepwise functionalization and bioconjugation of gold GNUs exhibiting an LSPR peak at 675 nm, PEG-functionalized GNUs, ADH-functionalized GNU-PEG with a peak at 220 nm, and mAb-conjugated GNU-PEG-ADH displaying a peak at 230 nm followed by a characteristic peak at 214 nm after the interaction. ( B ) Magnified view of ( A ) between 200 and 300 nm. ( C ) Magnification of ( B ) between 270 and 290 nm, where the mAb shows higher absorbance than HER-II, and the corresponding results for CA 15-3 from ( D – F ). Note the higher absorbance of CA 15-3 than the mAb.

    Journal: Biosensors

    Article Title: Dual-Oriented Targeted Nanostructured SERS Label-Free Immunosensor for Detection, Quantification, and Analysis of Breast Cancer Biomarker Concentrations in Blood Serum

    doi: 10.3390/bios15070447

    Figure Lengend Snippet: ( A ) UV–Vis spectra showing the stepwise functionalization and bioconjugation of gold GNUs exhibiting an LSPR peak at 675 nm, PEG-functionalized GNUs, ADH-functionalized GNU-PEG with a peak at 220 nm, and mAb-conjugated GNU-PEG-ADH displaying a peak at 230 nm followed by a characteristic peak at 214 nm after the interaction. ( B ) Magnified view of ( A ) between 200 and 300 nm. ( C ) Magnification of ( B ) between 270 and 290 nm, where the mAb shows higher absorbance than HER-II, and the corresponding results for CA 15-3 from ( D – F ). Note the higher absorbance of CA 15-3 than the mAb.

    Article Snippet: HER-II and CA15-3 monoclonal antibodies (mAbs) were purchased from SinoBiological (10004-MM03, HER-II/ErB 2 /CD340 Antibody, Mouse Mab, and 12123-MM05, MUC1/Mucin 1/CD227 Antibody, mouse Mab, respectively; Pennsylvania, USA). summarizes the characteristics of CA15-3 and the clinical status of the corresponding BCS samples.

    Techniques:

    SERS signals of standard HER-II solution for before (mAb-conjugated) and after interaction at various concentrations.

    Journal: Biosensors

    Article Title: Dual-Oriented Targeted Nanostructured SERS Label-Free Immunosensor for Detection, Quantification, and Analysis of Breast Cancer Biomarker Concentrations in Blood Serum

    doi: 10.3390/bios15070447

    Figure Lengend Snippet: SERS signals of standard HER-II solution for before (mAb-conjugated) and after interaction at various concentrations.

    Article Snippet: HER-II and CA15-3 monoclonal antibodies (mAbs) were purchased from SinoBiological (10004-MM03, HER-II/ErB 2 /CD340 Antibody, Mouse Mab, and 12123-MM05, MUC1/Mucin 1/CD227 Antibody, mouse Mab, respectively; Pennsylvania, USA). summarizes the characteristics of CA15-3 and the clinical status of the corresponding BCS samples.

    Techniques:

    The trials of the SERS results of the functionalization, conjugation, and interaction steps for (GNU-mAb)-HER-II.

    Journal: Biosensors

    Article Title: Dual-Oriented Targeted Nanostructured SERS Label-Free Immunosensor for Detection, Quantification, and Analysis of Breast Cancer Biomarker Concentrations in Blood Serum

    doi: 10.3390/bios15070447

    Figure Lengend Snippet: The trials of the SERS results of the functionalization, conjugation, and interaction steps for (GNU-mAb)-HER-II.

    Article Snippet: HER-II and CA15-3 monoclonal antibodies (mAbs) were purchased from SinoBiological (10004-MM03, HER-II/ErB 2 /CD340 Antibody, Mouse Mab, and 12123-MM05, MUC1/Mucin 1/CD227 Antibody, mouse Mab, respectively; Pennsylvania, USA). summarizes the characteristics of CA15-3 and the clinical status of the corresponding BCS samples.

    Techniques: Conjugation Assay

    SERS signals of standard CA15-3 solutions for before (mAb-conjugated) and after interaction at various concentrations.

    Journal: Biosensors

    Article Title: Dual-Oriented Targeted Nanostructured SERS Label-Free Immunosensor for Detection, Quantification, and Analysis of Breast Cancer Biomarker Concentrations in Blood Serum

    doi: 10.3390/bios15070447

    Figure Lengend Snippet: SERS signals of standard CA15-3 solutions for before (mAb-conjugated) and after interaction at various concentrations.

    Article Snippet: HER-II and CA15-3 monoclonal antibodies (mAbs) were purchased from SinoBiological (10004-MM03, HER-II/ErB 2 /CD340 Antibody, Mouse Mab, and 12123-MM05, MUC1/Mucin 1/CD227 Antibody, mouse Mab, respectively; Pennsylvania, USA). summarizes the characteristics of CA15-3 and the clinical status of the corresponding BCS samples.

    Techniques:

    The trials of the SERS results of the functionalization, conjugation, and interaction steps for (GNU-mAb)-CA15-3.

    Journal: Biosensors

    Article Title: Dual-Oriented Targeted Nanostructured SERS Label-Free Immunosensor for Detection, Quantification, and Analysis of Breast Cancer Biomarker Concentrations in Blood Serum

    doi: 10.3390/bios15070447

    Figure Lengend Snippet: The trials of the SERS results of the functionalization, conjugation, and interaction steps for (GNU-mAb)-CA15-3.

    Article Snippet: HER-II and CA15-3 monoclonal antibodies (mAbs) were purchased from SinoBiological (10004-MM03, HER-II/ErB 2 /CD340 Antibody, Mouse Mab, and 12123-MM05, MUC1/Mucin 1/CD227 Antibody, mouse Mab, respectively; Pennsylvania, USA). summarizes the characteristics of CA15-3 and the clinical status of the corresponding BCS samples.

    Techniques: Conjugation Assay

    SERS signals of CA15-3 BCS samples for before (mAb-conjugated) and after interaction at various concentrations.

    Journal: Biosensors

    Article Title: Dual-Oriented Targeted Nanostructured SERS Label-Free Immunosensor for Detection, Quantification, and Analysis of Breast Cancer Biomarker Concentrations in Blood Serum

    doi: 10.3390/bios15070447

    Figure Lengend Snippet: SERS signals of CA15-3 BCS samples for before (mAb-conjugated) and after interaction at various concentrations.

    Article Snippet: HER-II and CA15-3 monoclonal antibodies (mAbs) were purchased from SinoBiological (10004-MM03, HER-II/ErB 2 /CD340 Antibody, Mouse Mab, and 12123-MM05, MUC1/Mucin 1/CD227 Antibody, mouse Mab, respectively; Pennsylvania, USA). summarizes the characteristics of CA15-3 and the clinical status of the corresponding BCS samples.

    Techniques:

    PCA plots for various stages of interaction: ( A ) GNU-mAb + HER-II, ( B ) GNU-mAb + CA15-3, and ( C ) GNU-mAb+HBS.

    Journal: Biosensors

    Article Title: Dual-Oriented Targeted Nanostructured SERS Label-Free Immunosensor for Detection, Quantification, and Analysis of Breast Cancer Biomarker Concentrations in Blood Serum

    doi: 10.3390/bios15070447

    Figure Lengend Snippet: PCA plots for various stages of interaction: ( A ) GNU-mAb + HER-II, ( B ) GNU-mAb + CA15-3, and ( C ) GNU-mAb+HBS.

    Article Snippet: HER-II and CA15-3 monoclonal antibodies (mAbs) were purchased from SinoBiological (10004-MM03, HER-II/ErB 2 /CD340 Antibody, Mouse Mab, and 12123-MM05, MUC1/Mucin 1/CD227 Antibody, mouse Mab, respectively; Pennsylvania, USA). summarizes the characteristics of CA15-3 and the clinical status of the corresponding BCS samples.

    Techniques: